CpG-Oligonukleotid 7909
CpG-Oligonukleotid 7909 (auch CpG 7909, Agatolimod) ist ein CpG-Oligonukleotid, das an den TLR9 bindet und daher in der Immunologie und Pharmakologie als Adjuvans verwendet wird.
| Nukleinsäure | |
|---|---|
| TCGTCGTTTTGTCGTTTTGTCGTT | |
| Allgemeines | |
| Freiname | Agatolimod[1] |
| Andere Namen |
|
| Identifikatoren | |
| GenBank | |
| CAS-Nummer |
207623-20-9 |
| PubChem | |
| Wirkstoffdaten | |
| DrugBank | |
| Eigenschaften | |
| Größe |
24 Nukleotide, 7698,21 Da |
| Taxon |
synthetisch |
Eigenschaften
CpG 7909 wird synthetisch per Phosphoramidit-Methode hergestellt. Es hat die Sequenz: 5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′. Das Phosphodiester-Desoxyribose-Rückgrat ist hierbei zu einem Phosphorthioat modifiziert. Dabei wird ein nicht an der Phosphatbrücke beteiligtes Sauerstoffatom durch ein Schwefelatom ersetzt.[3] Dadurch wird es resistent gegenüber DNasen.
Anwendungen
CpG 7909 wird in einer Variante des Anthraximpfstoffs BioThrax verwendet.[4]
Literatur
- CpG 7909: PF 3512676, PF-3512676. In: Drugs in R&D. Band 7, Nummer 5, 2006, S. 312–316, doi:10.2165/00126839-200607050-00004, PMID 16922592.
- A. M. Krieg, A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman: CpG motifs in bacterial DNA trigger direct B-cell activation. In: Nature. Band 374, Nummer 6522, April 1995, S. 546–549, doi:10.1038/374546a0, PMID 7700380.
Weblinks
Einzelnachweise
- INN Recommended List 60, World Health Organisation (WHO), 9. September 2008.
- PubChem: Agatolimod sodium | C238H291N75Na23O127P23S23 | CID 56841789 - PubChem, abgerufen am 20. August 2023.
- Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto jr., Lubert Stryer: Stryer Biochemie. Katalytische Strategien. 8. Auflage. Springer, 2018, ISBN 978-3-662-54619-2, S. 321, doi:10.1007/978-3-662-54620-8_9.
- Jingxing Yang, Jen-Chih Tseng, Guann-Yi Yu, Yunping Luo, Chi-Ying F. Huang, Yi-Ren Hong, Tsung-Hsien Chuang: Recent Advances in the Development of Toll-like Receptor Agonist-Based Vaccine Adjuvants for Infectious Diseases. In: Pharmaceutics. 2022, Band 14, Nummer 2, S. 423 doi:10.3390/pharmaceutics14020423. PMID 35214155. PMC 8878135 (freier Volltext).
This article is issued from Wikipedia. The text is licensed under Creative Commons - Attribution - Sharealike. Additional terms may apply for the media files.